Logo Search packages:      
Sourcecode: python-biopython version File versions  Download package

test_CAPS.py

from Bio import CAPS
import unittest
from Bio.Restriction import *
from Bio.Fasta import FastaAlign
from StringIO import StringIO
from tempfile import NamedTemporaryFile

def createAlignment(alignment):
  """Create a FastaAlignment from an alignment string"""
  alignment = alignment[alignment.find(">"):]
  
  tmp = NamedTemporaryFile(bufsize=0)
  tmp.write(alignment)
  tmp.flush()
  align = FastaAlign.parse_file(str(tmp.name))
  return align

00018 class UnevenAlignment(unittest.TestCase):
  alignment = """
>foo1
aaaaaaaaaaaaaa
>foo2
aaaaaaaa
>foo3
aaaaaaaaaaaaaa
"""

  def setUp(self):
    self.align = createAlignment(self.alignment)

  def test(self):
    self.assertRaises(CAPS.AlignmentHasDifferentLengthsError, CAPS.CAPSMap, self.align)

00034 class FastaAlignmentTest(unittest.TestCase):

  alignment = """"""
  
  enzymes = []
  
  def setUp(self):

    align = createAlignment(self.alignment)
    self.map = CAPS.CAPSMap(align, self.enzymes)

00045 class NonExample(FastaAlignmentTest):

  alignment = """
>Sequence1
aaaaaaaaaaaaaaaaaaaa
>Sequence2
aaaaaaaaaaaaaaaaaaaa
"""
  
  def testNoCAPS(self):
    self.assertEqual(self.map.dcuts, [])

00057 class ResultChecker(FastaAlignmentTest):
  """This class builds an alignment and then checks the results
  
  subclass it and expose fields:

  alignment - Text representation of the alignment to analyze
  enzymes - The enzymes to analyze this with

  
  """

  def check(self):
    self.assertEqual(len(self.map.dcuts), len(self.results))

    for i in range(0,len(self.results)):
      self.assertEqual(self.results[i][0], self.map.dcuts[i].enzyme)
      self.assertEqual(self.results[i][1], self.map.dcuts[i].start)
      self.assertEqual(self.results[i][2], self.map.dcuts[i].cuts_in)
      self.assertEqual(self.results[i][3], self.map.dcuts[i].blocked_in)

00077 class Example1(ResultChecker):

  alignment = """
>0
AAAagaattcTAGATATACCAAACCAGAGAAAACAAATACATAATCGGAGAAATACAGAT
AGAGAGCGAGAGAGATCGACGGCGAAGCTCTTTACCCGGAAACCATTGAAATCGGACGGT
TTAGTGAAAATGGAGGATCAAGTagAtTTTGGGTTCCGTCCGAACGACGAGGAGCTCGTT
GGTCACTATCTCCGTAACAAAATCGAAGGAAACACTAGCCGCGACGTTGAAGTAGCCATC
AGCGAGGTCAACATCTGTAGCTACGATCCTTGGAACTTGCGCTGTAAGTTCCGAATTTTC
>1
AAAagaTttcTAGATATACCAAACCAGAGAAAACAAATACATAATCGGAGAAATACAGAT
AGAGAGCGAGAGAGATCGACGGCGAAGCTCTTTACCCGGAAACCATTGAAATCGGACGGT
TTAGTGAAAATGGAGGATCAAGTagctTTTGGGTTCCGTCCGAACGACGAGGAGCTCGTT
GGTCACTATCTCCGTAACAAAATCGAAGGAAACACTAGCCGCGACGTTGAAGTAGCCATC
AGCGAGGTCAACATCTGTAGCTACGATCCTTGGAACTTGCGCTGTAAGTTCCGAATTTTC
>2
AAAagaTttcTAGATATACCAAACCAGAGAAAACAAATACATAATCGGAGAAATACAGAT
AGAGAGCGAGAGAGATCGACGGCGAAGCTCTTTACCCGGAAACCATTGAAATCGGACGGT
TTAGTGAAAATGGAGGATCAAGTagctTTTGGGTTCCGTCCGAACGACGAGGAGCTCGTT
GGTCACTATCTCCGTAACAAAATCGAAGGAAACACTAGCCGCGACGTTGAAGTAGCCATC
AGCGAGGTCAACATCTGTAGCTACGATCCTTGGAACTTGCGCTGTAAGTTCCGAATTTTC
"""

  enzymes = [EcoRI, AluI]

  results = []
  results.append([EcoRI, 5, [0], [1,2]])
  results.append([AluI, 144, [1,2], [0]])
  
  def test(self):
    self.check()


00110 class TrivialExample(FastaAlignmentTest):

  alignment = """
>1
gaattc
>2
gaactc
"""

  enzymes = [EcoRI]

  def testCAPS(self):
    self.assertEqual(len(self.map.dcuts), 1)
    self.assertEqual(self.map.dcuts[0].enzyme, EcoRI)
    self.assertEqual(self.map.dcuts[0].start, 1)
    self.assertEqual(self.map.dcuts[0].cuts_in, [0])
    self.assertEqual(self.map.dcuts[0].blocked_in, [1])
    
def test_suite():
  suite = unittest.TestSuite()
  suite.addTest(UnevenAlignment("test"))
  suite.addTest(TrivialExample("testCAPS"))
  suite.addTest(Example1("test"))

  return suite

runner = unittest.TextTestRunner()
runner.run(test_suite())

Generated by  Doxygen 1.6.0   Back to index