Logo Search packages:      
Sourcecode: python-biopython version File versions


#!/usr/bin/env python
"""Tests for Primer-based programs in the Emboss suite.
# standard library
import sys
import os
import unittest

# local stuff
from Bio.Emboss import PrimerSearch, Primer3

class Primer3ParseTest(unittest.TestCase):
    def setUp(self):
        self.test_files = \
          [os.path.join("Emboss", "bac_find.primer3"),
           os.path.join("Emboss", "cds_forward.primer3"),
           os.path.join("Emboss", "cds_reverse.primer3"),
           os.path.join("Emboss", "short.primer3"),
           os.path.join("Emboss", "internal_oligo.primer3")

    def test_simple_parse(self):
        """Make sure that we can parse all primer3 files.
        for file in self.test_files:
            h = open(file, "r")

    def test_indepth_regular_parse(self):
        """Make sure we get the data from normal primer3 files okay.
        regular_file = self.test_files[0]
        h = open(regular_file, "r")
        primer_info = Primer3.read(h)

        assert len(primer_info.primers) == 5, \
          "Wrong number of primers: %s" % len(primer_info.primers)

        assert primer_info.primers[1].forward_seq \
        assert primer_info.primers[2].reverse_seq == \
        assert primer_info.primers[0].size == 218
        assert primer_info.primers[3].forward_start == 112
        assert primer_info.primers[3].forward_length == 20
        assert primer_info.primers[3].forward_tm == 59.57
        assert primer_info.primers[3].forward_gc == 45.00

        assert primer_info.primers[4].reverse_start == 304
        assert primer_info.primers[4].reverse_length == 22
        assert primer_info.primers[4].reverse_tm == 59.61
        assert primer_info.primers[4].reverse_gc == 40.91

    def test_in_depth_single_parse(self):
        """Make sure we get info right from a single primer find.
        file = self.test_files[1]
        h = open(file, "r")
        primer_info = Primer3.read(h)

        assert len(primer_info.primers) == 5
        assert primer_info.primers[1].reverse_seq == ""

        assert primer_info.primers[3].forward_seq == "TGTGATTGCTTGAGCTGGAC"
        assert primer_info.primers[3].forward_start == 253

    def test_internal_oligo_single_parse(self):
        ''' Make sure we can parse an internal oligo file correctly '''
        # these files are generated when designing hybridization probes.
        file = self.test_files[4]
        h = open(file, "r")
        primer_info = Primer3.read(h)

        assert len(primer_info.primers) == 5
        assert primer_info.primers[0].internal_length == 22 
        assert primer_info.primers[1].internal_seq == 'TTGCGCTTTAGTTTGAATTGAA'
        assert primer_info.primers[2].internal_tm == 58.62 
        assert primer_info.primers[3].internal_start == 16 
        assert primer_info.primers[4].internal_gc == 35.00 

class PrimersearchParseTest(unittest.TestCase):
    def setUp(self):
        self.test_files = \
          [os.path.join("Emboss", "bac_find.psearch")]

    def test_simple_parse(self):
        """Make sure that we can parse all primersearch files.
        for file in self.test_files:
            h = open(file, "r")

    def test_in_depth_normal_parse(self):
        """Make sure the output from a simple primersearch file is correct.
        file = self.test_files[0]
        h = open(file, "r")
        amp_info = PrimerSearch.read(h)

        assert len(amp_info.amplifiers.keys()) == 1
        assert "Test" in amp_info.amplifiers.keys()
        assert len(amp_info.amplifiers["Test"]) == 1

        assert amp_info.amplifiers["Test"][0].length == 218
        assert amp_info.amplifiers["Test"][0].hit_info == \
          "AC074298 AC074298 \n" + \
          "\tTelomere associated sequence for Arabidopsis thaliana " + \
          "TEL1N from chromosome I, complete sequence.\n" + \
          "\tCCGGTTTCTCTGGTTGAAAA hits forward strand at 114 with " + \
          "0 mismatches\n" + \
          "\tTCACATTCCCAAATGTAGATCG hits reverse strand at [114] with " + \
          "0 mismatches"

00122 class PrimerSearchInputTest(unittest.TestCase):
    """Test creating input files for primersearch.
    def setUp(self):

00128     def test_primer_representation(self):
        """Make sure we can output primer information correctly.
        p_info = PrimerSearch.InputRecord()
        p_info.add_primer_set("Test", "GATC", "CATG")
        p_info.add_primer_set("Test2", "AATA", "TTAT")

        output = str(p_info)
        assert output == "Test GATC CATG\n" + \
                         "Test2 AATA TTAT\n"

if __name__ == "__main__":
    runner = unittest.TextTestRunner(verbosity = 2)

Generated by  Doxygen 1.6.0   Back to index