Logo Search packages:      
Sourcecode: python-biopython version File versions  Download package

PhylipIO.py

# Copyright 2006-2009 by Peter Cock.  All rights reserved.
# This code is part of the Biopython distribution and governed by its
# license.  Please see the LICENSE file that should have been included
# as part of this package.
"""
AlignIO support for the "phylip" format used in Joe Felsenstein's PHYLIP tools.

You are expected to use this module via the Bio.AlignIO functions (or the
Bio.SeqIO functions if you want to work directly with the gapped sequences).

Note
====
In TREE_PUZZLE (Schmidt et al. 2003) and PHYML (Guindon and Gascuel 2003)
a dot/period (".") in a sequence is interpreted as meaning the same
character as in the first sequence.  The PHYLIP 3.6 documentation says:

   "a period was also previously allowed but it is no longer allowed,
   because it sometimes is used in different senses in other programs"

At the time of writing, we do nothing special with a dot/period.
"""
   
from Bio.Alphabet import single_letter_alphabet
from Bio.Align.Generic import Alignment
from Interfaces import AlignmentIterator, SequentialAlignmentWriter

00027 class PhylipWriter(SequentialAlignmentWriter):
    """Phylip alignment writer."""
00029     def write_alignment(self, alignment):
        """Use this to write (another) single alignment to an open file.

        This code will write interlaced alignments (when the sequences are
        longer than 50 characters).

        Note that record identifiers are strictly truncated at 10 characters.

        For more information on the file format, please see:
        http://evolution.genetics.washington.edu/phylip/doc/sequence.html
        http://evolution.genetics.washington.edu/phylip/doc/main.html#inputfiles
        """
        truncate=10
        records = alignment.get_all_seqs()
        handle = self.handle        
        
        if len(records)==0:
            raise ValueError("Must have at least one sequence")
        length_of_seqs = alignment.get_alignment_length()
        for record in records:
            if length_of_seqs != len(record.seq):
                raise ValueError("Sequences must all be the same length")
        if length_of_seqs <= 0:
            raise ValueError("Non-empty sequences are required")
        
        if len(records) > len(set([r.id[:truncate] for r in records])):
            raise ValueError("Repeated identifier, possibly due to truncation")


        # From experimentation, the use of tabs is not understood by the
        # EMBOSS suite.  The nature of the expected white space is not
        # defined in the PHYLIP documentation, simply "These are in free
        # format, separated by blanks".  We'll use spaces to keep EMBOSS
        # happy.
        handle.write(" %i %s\n" % (len(records), length_of_seqs))
        block=0
        while True:
            for record in records:
                if block==0:
                    #Write name (truncated/padded to 10 characters)
                    """
                    Quoting the PHYLIP version 3.6 documentation:
                    
                    The name should be ten characters in length, filled out to
                    the full ten characters by blanks if shorter. Any printable
                    ASCII/ISO character is allowed in the name, except for
                    parentheses ("(" and ")"), square brackets ("[" and "]"),
                    colon (":"), semicolon (";") and comma (","). If you forget
                    to extend the names to ten characters in length by blanks,
                    the program [i.e. PHYLIP] will get out of synchronization
                    with the contents of the data file, and an error message will
                    result.

                    Note that Tab characters count as only one character in the
                    species names. Their inclusion can cause trouble.
                    """
                    name = record.id.strip()
                    #Either remove the banned characters, or map them to something
                    #else like an underscore "_" or pipe "|" character...
                    for char in "[](),":
                        name = name.replace(char,"")
                    for char in ":;":
                        name = name.replace(char,"|")

                    #Now truncate and right pad to expected length.
                    handle.write(name[:truncate].ljust(truncate))
                else:
                    #write 10 space indent
                    handle.write(" "*truncate)
                #Write five chunks of ten letters per line...
                for chunk in range(0,5):
                    i = block*50 + chunk*10
                    seq_segment = record.seq.tostring()[i:i+10]
                    #TODO - Force any gaps to be '-' character?  Look at the alphabet...
                    #TODO - How to cope with '?' or '.' in the sequence?
                    handle.write(" %s" % seq_segment)
                    if i+10 > length_of_seqs : break
                handle.write("\n")
            block=block+1
            if block*50 > length_of_seqs : break
            handle.write("\n")

00111 class PhylipIterator(AlignmentIterator):
    """Reads a Phylip alignment file returning an Alignment object iterator.

    Record identifiers are limited to at most 10 characters.

    It only copes with interlaced phylip files!  Sequential files won't work
    where the sequences are split over multiple lines.

    For more information on the file format, please see:
    http://evolution.genetics.washington.edu/phylip/doc/sequence.html
    http://evolution.genetics.washington.edu/phylip/doc/main.html#inputfiles
    """

    def _is_header(self, line):
        line = line.strip()
        parts = filter(None, line.split())
        if len(parts)!=2:
            return False # First line should have two integers
        try:
            number_of_seqs = int(parts[0])
            length_of_seqs = int(parts[1])
            return True
        except ValueError:
            return False # First line should have two integers

    def next(self):
        handle = self.handle

        try:
            #Header we saved from when we were parsing
            #the previous alignment.
            line = self._header
            del self._header
        except AttributeError:
            line = handle.readline()

        if not line: return
        line = line.strip()
        parts = filter(None, line.split())
        if len(parts)!=2:
            raise ValueError("First line should have two integers")
        try:
            number_of_seqs = int(parts[0])
            length_of_seqs = int(parts[1])
        except ValueError:
            raise ValueError("First line should have two integers")

        assert self._is_header(line)

        if self.records_per_alignment is not None \
        and self.records_per_alignment != number_of_seqs:
            raise ValueError("Found %i records in this alignment, told to expect %i" \
                             % (number_of_seqs, self.records_per_alignment))

        ids = []
        seqs = []

        #Expects STRICT truncation/padding to 10 characters
        #Does not require any white space between name and seq.
        for i in range(0,number_of_seqs):
            line = handle.readline().rstrip()
            ids.append(line[:10].strip()) #first ten characters
            seqs.append([line[10:].strip().replace(" ","")])

        #Look for further blocks
        line=""
        while True:
            #Skip any blank lines between blocks...
            while ""==line.strip():
                line = handle.readline()
                if not line : break #end of file
            if not line : break #end of file

            if self._is_header(line):
                #Looks like the start of a concatenated alignment
                self._header = line
                break

            #print "New block..."
            for i in range(0,number_of_seqs):
                seqs[i].append(line.strip().replace(" ",""))
                line = handle.readline()
                if (not line) and i+1 < number_of_seqs:
                    raise ValueError("End of file mid-block")
            if not line : break #end of file

        alignment = Alignment(self.alphabet)
        for i in range(0,number_of_seqs):
            seq = "".join(seqs[i])
            if len(seq)!=length_of_seqs:
                raise ValueError("Sequence %i length %i, expected length %i" \
                                  % (i+1, len(seq), length_of_seqs))
            alignment.add_sequence(ids[i], seq)
            
            record = alignment.get_all_seqs()[-1]
            assert ids[i] == record.id or ids[i] == record.description
            record.id = ids[i]
            record.name = ids[i]
            record.description = ids[i]
        return alignment

if __name__=="__main__":
    print "Running short mini-test"

    phylip_text="""     8    286
V_Harveyi_ --MKNWIKVA VAAIA--LSA A--------- ---------T VQAATEVKVG 
B_subtilis MKMKKWTVLV VAALLAVLSA CG-------- ----NGNSSS KEDDNVLHVG 
B_subtilis MKKALLALFM VVSIAALAAC GAGNDNQSKD NAKDGDLWAS IKKKGVLTVG 
YA80_HAEIN MKKLLFTTAL LTGAIAFSTF ---------- -SHAGEIADR VEKTKTLLVG 
FLIY_ECOLI MKLAHLGRQA LMGVMAVALV AG---MSVKS FADEG-LLNK VKERGTLLVG 
E_coli_Gln --MKSVLKVS LAALTLAFAV S--------- ---------S HAADKKLVVA 
Deinococcu -MKKSLLSLK LSGLLVPSVL ALS------- -LSACSSPSS TLNQGTLKIA 
HISJ_E_COL MKKLVLSLSL VLAFSSATAA F--------- ---------- AAIPQNIRIG 

           MSGRYFPFTF VKQ--DKLQG FEVDMWDEIG KRNDYKIEYV TANFSGLFGL 
           ATGQSYPFAY KEN--GKLTG FDVEVMEAVA KKIDMKLDWK LLEFSGLMGE 
           TEGTYEPFTY HDKDTDKLTG YDVEVITEVA KRLGLKVDFK ETQWGSMFAG 
           TEGTYAPFTF HDK-SGKLTG FDVEVIRKVA EKLGLKVEFK ETQWDAMYAG 
           LEGTYPPFSF QGD-DGKLTG FEVEFAQQLA KHLGVEASLK PTKWDGMLAS 
           TDTAFVPFEF KQG--DKYVG FDVDLWAAIA KELKLDYELK PMDFSGIIPA 
           MEGTYPPFTS KNE-QGELVG FDVDIAKAVA QKLNLKPEFV LTEWSGILAG 
           TDPTYAPFES KNS-QGELVG FDIDLAKELC KRINTQCTFV ENPLDALIPS 

           LETGRIDTIS NQITMTDARK AKYLFADPYV VDG-AQITVR KGNDSIQGVE 
           LQTGKLDTIS NQVAVTDERK ETYNFTKPYA YAG-TQIVVK KDNTDIKSVD 
           LNSKRFDVVA NQVG-KTDRE DKYDFSDKYT TSR-AVVVTK KDNNDIKSEA 
           LNAKRFDVIA NQTNPSPERL KKYSFTTPYN YSG-GVIVTK SSDNSIKSFE 
           LDSKRIDVVI NQVTISDERK KKYDFSTPYT ISGIQALVKK GNEGTIKTAD 
           LQTKNVDLAL AGITITDERK KAIDFSDGYY KSG-LLVMVK ANNNDVKSVK 
           LQANKYDVIV NQVGITPERQ NSIGFSQPYA YSRPEIIVAK NNTFNPQSLA 
           LKAKKIDAIM SSLSITEKRQ QEIAFTDKLY AADSRLVVAK NSDIQP-TVE 

           DLAGKTVAVN LGSNFEQLLR DYDKDGKINI KTYDT--GIE HDVALGRADA 
           DLKGKTVAAV LGSNHAKNLE SKDPDKKINI KTYETQEGTL KDVAYGRVDA 
           DVKGKTSAQS LTSNYNKLAT N----AGAKV EGVEGMAQAL QMIQQARVDM 
           DLKGRKSAQS ATSNWGKDAK A----AGAQI LVVDGLAQSL ELIKQGRAEA 
           DLKGKKVGVG LGTNYEEWLR QNV--QGVDV RTYDDDPTKY QDLRVGRIDA 
           DLDGKVVAVK SGTGSVDYAK AN--IKTKDL RQFPNIDNAY MELGTNRADA 
           DLKGKRVGST LGSNYEKQLI DTG---DIKI VTYPGAPEIL ADLVAGRIDA 
           SLKGKRVGVL QGTTQETFGN EHWAPKGIEI VSYQGQDNIY SDLTAGRIDA 

           FIMDRLSALE -LIKKT-GLP LQLAGEPFET I-----QNAW PFVDNEKGRK 
           YVNSRTVLIA -QIKKT-GLP LKLAGDPIVY E-----QVAF PFAKDDAHDK 
           TYNDKLAVLN -YLKTSGNKN VKIAFETGEP Q-----STYF TFRKGS--GE 
           TINDKLAVLD -YFKQHPNSG LKIAYDRGDK T-----PTAF AFLQGE--DA 
           ILVDRLAALD -LVKKT-NDT LAVTGEAFSR Q-----ESGV ALRKGN--ED 
           VLHDTPNILY -FIKTAGNGQ FKAVGDSLEA Q-----QYGI AFPKGS--DE 
           AYNDRLVVNY -IINDQ-KLP VRGAGQIGDA A-----PVGI ALKKGN--SA 
           AFQDEVAASE GFLKQPVGKD YKFGGPSVKD EKLFGVGTGM GLRKED--NE 

           LQAEVNKALA EMRADGTVEK ISVKWFGADI TK----
           LRKKVNKALD ELRKDGTLKK LSEKYFNEDI TVEQKH
           VVDQVNKALK EMKEDGTLSK ISKKWFGEDV SK----
           LITKFNQVLE ALRQDGTLKQ ISIEWFGYDI TQ----
           LLKAVNDAIA EMQKDGTLQA LSEKWFGADV TK----
           LRDKVNGALK TLRENGTYNE IYKKWFGTEP K-----
           LKDQIDKALT EMRSDGTFEK ISQKWFGQDV GQP---
           LREALNKAFA EMRADGTYEK LAKKYFDFDV YGG---
"""

    from cStringIO import StringIO
    handle = StringIO(phylip_text)
    count=0
    for alignment in PhylipIterator(handle):
        for record in alignment.get_all_seqs():
            count=count+1
            print record.id
            #print record.seq.tostring()
    assert count == 8

    expected="""mkklvlslsl vlafssataa faaipqniri gtdptyapfe sknsqgelvg
    fdidlakelc krintqctfv enpldalips lkakkidaim sslsitekrq qeiaftdkly
    aadsrlvvak nsdiqptves lkgkrvgvlq gttqetfgne hwapkgieiv syqgqdniys
    dltagridaafqdevaaseg flkqpvgkdy kfggpsvkde klfgvgtgmg lrkednelre
    alnkafaemradgtyeklak kyfdfdvygg""".replace(" ","").replace("\n","").upper()
    assert record.seq.tostring().replace("-","") == expected

    #From here:
    #http://atgc.lirmm.fr/phyml/usersguide.html
    phylip_text2="""5 60
Tax1        CCATCTCACGGTCGGTACGATACACCTGCTTTTGGCAG
Tax2        CCATCTCACGGTCAGTAAGATACACCTGCTTTTGGCGG
Tax3        CCATCTCCCGCTCAGTAAGATACCCCTGCTGTTGGCGG
Tax4        TCATCTCATGGTCAATAAGATACTCCTGCTTTTGGCGG
Tax5        CCATCTCACGGTCGGTAAGATACACCTGCTTTTGGCGG

GAAATGGTCAATATTACAAGGT
GAAATGGTCAACATTAAAAGAT
GAAATCGTCAATATTAAAAGGT
GAAATGGTCAATCTTAAAAGGT
GAAATGGTCAATATTAAAAGGT"""

    phylip_text3="""5 60
Tax1        CCATCTCACGGTCGGTACGATACACCTGCTTTTGGCAGGAAATGGTCAATATTACAAGGT
Tax2        CCATCTCACGGTCAGTAAGATACACCTGCTTTTGGCGGGAAATGGTCAACATTAAAAGAT
Tax3        CCATCTCCCGCTCAGTAAGATACCCCTGCTGTTGGCGGGAAATCGTCAATATTAAAAGGT
Tax4        TCATCTCATGGTCAATAAGATACTCCTGCTTTTGGCGGGAAATGGTCAATCTTAAAAGGT
Tax5        CCATCTCACGGTCGGTAAGATACACCTGCTTTTGGCGGGAAATGGTCAATATTAAAAGGT"""

    handle = StringIO(phylip_text2)
    list2 = list(PhylipIterator(handle))
    handle.close()
    assert len(list2)==1
    assert len(list2[0].get_all_seqs())==5

    handle = StringIO(phylip_text3)
    list3 = list(PhylipIterator(handle))
    handle.close()
    assert len(list3)==1
    assert len(list3[0].get_all_seqs())==5

    for i in range(0,5):
        list2[0].get_all_seqs()[i].id == list3[0].get_all_seqs()[i].id
        list2[0].get_all_seqs()[i].seq.tostring() == list3[0].get_all_seqs()[i].seq.tostring()

    #From here:
    #http://evolution.genetics.washington.edu/phylip/doc/sequence.html
    #Note the lack of any white space between names 2 and 3 and their seqs.
    phylip_text4="""  5    42
Turkey    AAGCTNGGGC ATTTCAGGGT
Salmo gairAAGCCTTGGC AGTGCAGGGT
H. SapiensACCGGTTGGC CGTTCAGGGT
Chimp     AAACCCTTGC CGTTACGCTT
Gorilla   AAACCCTTGC CGGTACGCTT

GAGCCCGGGC AATACAGGGT AT
GAGCCGTGGC CGGGCACGGT AT
ACAGGTTGGC CGTTCAGGGT AA
AAACCGAGGC CGGGACACTC AT
AAACCATTGC CGGTACGCTT AA"""

    #From here:
    #http://evolution.genetics.washington.edu/phylip/doc/sequence.html
    phylip_text5="""  5    42
Turkey    AAGCTNGGGC ATTTCAGGGT
GAGCCCGGGC AATACAGGGT AT
Salmo gairAAGCCTTGGC AGTGCAGGGT
GAGCCGTGGC CGGGCACGGT AT
H. SapiensACCGGTTGGC CGTTCAGGGT
ACAGGTTGGC CGTTCAGGGT AA
Chimp     AAACCCTTGC CGTTACGCTT
AAACCGAGGC CGGGACACTC AT
Gorilla   AAACCCTTGC CGGTACGCTT
AAACCATTGC CGGTACGCTT AA"""

    phylip_text5a="""  5    42
Turkey    AAGCTNGGGC ATTTCAGGGT GAGCCCGGGC AATACAGGGT AT
Salmo gairAAGCCTTGGC AGTGCAGGGT GAGCCGTGGC CGGGCACGGT AT
H. SapiensACCGGTTGGC CGTTCAGGGT ACAGGTTGGC CGTTCAGGGT AA
Chimp     AAACCCTTGC CGTTACGCTT AAACCGAGGC CGGGACACTC AT
Gorilla   AAACCCTTGC CGGTACGCTT AAACCATTGC CGGTACGCTT AA"""

    handle = StringIO(phylip_text4)
    list4 = list(PhylipIterator(handle))
    handle.close()
    assert len(list4)==1
    assert len(list4[0].get_all_seqs())==5

    handle = StringIO(phylip_text5)
    try:
        list5 = list(PhylipIterator(handle))
        assert len(list5)==1
        assert len(list5[0].get_all_seqs())==5
        print "That should have failed..."
    except ValueError:
        print "Evil multiline non-interlaced example failed as expected"
    handle.close()

    handle = StringIO(phylip_text5a)
    list5 = list(PhylipIterator(handle))
    handle.close()
    assert len(list5)==1
    assert len(list4[0].get_all_seqs())==5

    print "Concatenation"
    handle = StringIO(phylip_text4 + "\n" + phylip_text4)
    assert len(list(PhylipIterator(handle))) == 2

    handle = StringIO(phylip_text3 + "\n" + phylip_text4 + "\n\n\n" + phylip_text)
    assert len(list(PhylipIterator(handle))) == 3
    
    print "OK"

    print "Checking write/read"
    handle = StringIO()
    PhylipWriter(handle).write_file(list5)
    handle.seek(0)
    list6 = list(PhylipIterator(handle))
    assert len(list5) == len(list6)
    for a1,a2 in zip(list5, list6):
        assert len(a1.get_all_seqs()) == len(a2.get_all_seqs())
        for r1, r2 in zip(a1.get_all_seqs(), a2.get_all_seqs()):
            assert r1.id == r2.id
            assert r1.seq.tostring() == r2.seq.tostring()
    print "Done"

Generated by  Doxygen 1.6.0   Back to index