Logo Search packages:      
Sourcecode: python-biopython version File versions  Download package

test_SeqIO_features.py

# Copyright 2009-2010 by Peter Cock.  All rights reserved.
# This code is part of the Biopython distribution and governed by its
# license.  Please see the LICENSE file that should have been included
# as part of this package.

"""SeqFeature related tests for SeqRecord objects from Bio.SeqIO.

Initially this takes matched tests of GenBank and FASTA files from the NCBI
and confirms they are consistent using our different parsers.
"""
import os
import unittest
from Bio.Alphabet import generic_dna, generic_rna, generic_protein
from Bio import SeqIO
from Bio.Seq import Seq, UnknownSeq, MutableSeq, reverse_complement
from Bio.SeqRecord import SeqRecord
from Bio.SeqFeature import SeqFeature, FeatureLocation, ExactPosition, \
                           BeforePosition, AfterPosition, OneOfPosition, \
                           WithinPosition
from StringIO import StringIO
from Bio.SeqIO.InsdcIO import _insdc_feature_location_string

#Top level function as this makes it easier to use for debugging:
def write_read(filename, in_format="gb", out_formats=["gb", "embl"]):
    for out_format in out_formats:
        gb_records = list(SeqIO.parse(open(filename),in_format))
        #Write it out...
        handle = StringIO()
        SeqIO.write(gb_records, handle, out_format)
        handle.seek(0)
        #Now load it back and check it agrees,
        gb_records2 = list(SeqIO.parse(handle,out_format))
        compare_records(gb_records, gb_records2)

def compare_record(old, new, expect_minor_diffs=False):
    #Note the name matching is a bit fuzzy
    if not expect_minor_diffs \
    and old.id != new.id and old.name != new.name \
    and (old.id not in new.id) and (new.id not in old.id) \
    and (old.id.replace(" ","_") != new.id.replace(" ","_")):
        raise ValueError("'%s' or '%s' vs '%s' or '%s' records" \
                         % (old.id, old.name, new.id, new.name))
    if len(old.seq) != len(new.seq):
        raise ValueError("%i vs %i" % (len(old.seq), len(new.seq)))
    if isinstance(old.seq, UnknownSeq) \
    and isinstance(new.seq, UnknownSeq):
        #Jython didn't like us comparing the string of very long
        #UnknownSeq object (out of heap memory error)
        if old.seq._character.upper() != new.seq._character:
            raise ValueError("%s vs %s" % (repr(old.seq), repr(new.seq)))
    elif str(old.seq).upper() != str(new.seq).upper():
        if len(old.seq) < 200:
            raise ValueError("'%s' vs '%s'" % (old.seq, new.seq))
        else:
            raise ValueError("'%s...' vs '%s...'" % (old.seq[:100], new.seq[:100]))
    if old.features and new.features:
        if not compare_features(old.features, new.features):
            return False
    #Just insist on at least one word in common:
    if (old.description or new.description) \
    and not set(old.description.split()).intersection(new.description.split()):
        raise ValueError("%s versus %s" \
                         % (repr(old.description), repr(new.description)))
    #This only checks common annotation
    #Would a white list be easier?
    for key in set(old.annotations.keys()).intersection(new.annotations.keys()):
        if key in ["data_file_division", "accessions"]:
            #TODO - These are not yet supported on output, or
            #have other complications (e.g. different number of accessions
            #allowed in various file formats)
            continue
        if key == "comment":
            #Ignore whitespace
            if old.annotations[key].split() != new.annotations[key].split():
                raise ValueError("Annotation mis-match for comment:\n%s\n%s" \
                                % (old.annotations[key], new.annotations[key]))
            continue
        if key == "references":
            if expect_minor_diffs:
                #TODO - Implement EMBL output of references
                continue
            assert len(old.annotations[key]) == len(new.annotations[key])
            for r1, r2 in zip(old.annotations[key], new.annotations[key]):
                assert r1.title == r2.title
                assert r1.authors == r2.authors, \
                       "Old: '%s'\nNew: '%s'" % (r1.authors, r2.authors)
                assert r1.journal == r2.journal
                if r1.consrtm and r2.consrtm:
                    #Not held in EMBL files
                    assert r1.consrtm == r2.consrtm
                if r1.medline_id and r2.medline_id:
                    #Not held in EMBL files
                    assert r1.medline_id == r2.medline_id
                assert r1.pubmed_id == r2.pubmed_id
            continue
        if repr(old.annotations[key]) != repr(new.annotations[key]):
            raise ValueError("Annotation mis-match for %s:\n%s\n%s" \
                             % (key, old.annotations[key], new.annotations[key]))
    return True

def compare_records(old_list, new_list, expect_minor_diffs=False):
    """Check two lists of SeqRecords agree, raises a ValueError if mismatch."""
    if len(old_list) != len(new_list):
        raise ValueError("%i vs %i records" % (len(old_list), len(new_list)))
    for old, new in zip(old_list, new_list):
        if not compare_record(old,new,expect_minor_diffs):
            return False
    return True

def compare_feature(old, new, ignore_sub_features=False):
    """Check two SeqFeatures agree."""
    if old.type != new.type:
        raise ValueError("Type %s versus %s" % (old.type, new.type))
    if old.location.nofuzzy_start != new.location.nofuzzy_start \
    or old.location.nofuzzy_end != new.location.nofuzzy_end:
        raise ValueError("%s versus %s:\n%s\nvs:\n%s" \
                         % (old.location, new.location, str(old), str(new)))
    if old.strand != new.strand:
        raise ValueError("Different strand:\n%s\nvs:\n%s" % (str(old), str(new)))
    if old.ref != new.ref:
        raise ValueError("Different ref:\n%s\nvs:\n%s" % (str(old), str(new)))
    if old.ref_db != new.ref_db:
        raise ValueError("Different ref:\n%s\nvs:\n%s" % (str(old), str(new)))
    if old.location.start != new.location.start \
    or str(old.location.start) != str(new.location.start):
        raise ValueError("Start %s versus %s:\n%s\nvs:\n%s" \
                         % (old.location.start, new.location.start, str(old), str(new)))
    if old.location.end != new.location.end \
    or str(old.location.end) != str(new.location.end):
        raise ValueError("End %s versus %s:\n%s\nvs:\n%s" \
                         % (old.location.end, new.location.end, str(old), str(new)))
    if not ignore_sub_features:
        if len(old.sub_features) != len(new.sub_features):
            raise ValueError("Different sub features")
        for a,b in zip(old.sub_features, new.sub_features):
            if not compare_feature(a,b):
                return False
    #This only checks key shared qualifiers
    #Would a white list be easier?
    #for key in ["name","gene","translation","codon_table","codon_start","locus_tag"]:
    for key in set(old.qualifiers.keys()).intersection(new.qualifiers.keys()):
        if key in ["db_xref","protein_id","product","note"]:
            #EMBL and GenBank files are use different references/notes/etc
            continue
        if old.qualifiers[key] != new.qualifiers[key]:
            raise ValueError("Qualifier mis-match for %s:\n%s\n%s" \
                             % (key, old.qualifiers[key], new.qualifiers[key]))
    return True

def compare_features(old_list, new_list, ignore_sub_features=False):
    """Check two lists of SeqFeatures agree, raises a ValueError if mismatch."""
    if len(old_list) != len(new_list):
        raise ValueError("%i vs %i features" % (len(old_list), len(new_list)))
    for old, new in zip(old_list, new_list):
        #This assumes they are in the same order
        if not compare_feature(old,new,ignore_sub_features):
            return False
    return True

def make_join_feature(f_list, ftype="misc_feature"):
    #NOTE - Does NOT reorder the sub-features (which you may
    #want to do for reverse strand features...)
    strands = set(f.strand for f in f_list)
    if len(strands)==1:
        strand = f_list[0].strand
    else:
        strand = None
    for f in f_list:
        f.type=ftype
    jf = SeqFeature(FeatureLocation(f_list[0].location.start,
                                    f_list[-1].location.end),
                    type=ftype, strand=strand, location_operator="join")
    jf.sub_features = f_list
    return jf

00176 class SeqFeatureExtraction(unittest.TestCase):
    """Tests for SeqFeature sequence extract method."""

    def check(self, parent_seq, feature, answer_str):
        new = feature.extract(parent_seq)
        self.assert_(isinstance(new, Seq))
        self.assertEqual(str(new), answer_str)

        new = feature.extract(str(parent_seq))
        self.assert_(isinstance(new, str))
        self.assertEqual(new, answer_str)

        new = feature.extract(parent_seq.tomutable())
        self.assert_(isinstance(new, Seq)) #Not MutableSeq!
        self.assertEqual(str(new), answer_str)

        new = feature.extract(UnknownSeq(len(parent_seq), parent_seq.alphabet))
        self.assert_(isinstance(new, UnknownSeq))
        self.assertEqual(len(new), len(answer_str))

00196     def test_simple_rna(self):
        """Extract feature from RNA (simple, default strand)"""
        s = Seq("GAUCRYWSMKHBVDN", generic_rna)
        f = SeqFeature(FeatureLocation(5,10))
        self.assertEqual(_insdc_feature_location_string(f), "6..10")
        self.check(s, f, "YWSMK")

00203     def test_simple_dna(self):
        """Extract feature from DNA (simple, default strand)"""
        s = Seq("GATCRYWSMKHBVDN", generic_dna)
        f = SeqFeature(FeatureLocation(5,10))
        self.assertEqual(_insdc_feature_location_string(f), "6..10")
        self.check(s, f, "YWSMK")

00210     def test_single_letter_dna(self):
        """Extract feature from DNA (single letter, default strand)"""
        s = Seq("GATCRYWSMKHBVDN", generic_dna)
        f = SeqFeature(FeatureLocation(5,6))
        self.assertEqual(_insdc_feature_location_string(f), "6")
        self.check(s, f, "Y")

00217     def test_zero_len_dna(self):
        """Extract feature from DNA (between location, zero length, default strand)"""
        s = Seq("GATCRYWSMKHBVDN", generic_dna)
        f = SeqFeature(FeatureLocation(5,5))
        self.assertEqual(_insdc_feature_location_string(f), "5^6")
        self.check(s, f, "")

00224     def test_simple_dna_strand0(self):
        """Extract feature from DNA (simple, strand 0)"""
        s = Seq("GATCRYWSMKHBVDN", generic_dna)
        f = SeqFeature(FeatureLocation(5,10), strand=0)
        self.assertEqual(_insdc_feature_location_string(f), "6..10")
        self.check(s, f, "YWSMK")

00231     def test_simple_dna_strand_none(self):
        """Extract feature from DNA (simple, strand None)"""
        s = Seq("GATCRYWSMKHBVDN", generic_dna)
        f = SeqFeature(FeatureLocation(5,10), strand=None)
        self.assertEqual(_insdc_feature_location_string(f), "6..10")
        self.check(s, f, "YWSMK")

00238     def test_simple_dna_strand1(self):
        """Extract feature from DNA (simple, strand +1)"""
        s = Seq("GATCRYWSMKHBVDN", generic_dna)
        f = SeqFeature(FeatureLocation(5,10), strand=1)
        self.assertEqual(_insdc_feature_location_string(f), "6..10")
        self.check(s, f, "YWSMK")
        
00245     def test_simple_dna_strand_minus(self):
        """Extract feature from DNA (simple, strand -1)"""
        s = Seq("GATCRYWSMKHBVDN", generic_dna)
        f = SeqFeature(FeatureLocation(5,10), strand=-1)
        self.assertEqual(_insdc_feature_location_string(f),
                         "complement(6..10)")
        self.check(s, f, "MKSWR")

00253     def test_simple_dna_join(self):
        """Extract feature from DNA (join, strand +1)"""
        s = Seq("GATCRYWSMKHBVDN", generic_dna)
        f1 = SeqFeature(FeatureLocation(5,10), strand=1)
        f2 = SeqFeature(FeatureLocation(12,15), strand=1)
        f = make_join_feature([f1,f2])
        self.assertEqual(_insdc_feature_location_string(f),
                         "join(6..10,13..15)")
        self.check(s, f, "YWSMKVDN")

00263     def test_simple_dna_join(self):
        """Extract feature from DNA (join, strand -1)"""
        s = Seq("AAAAACCCCCTTTTTGGGGG", generic_dna)
        f1 = SeqFeature(FeatureLocation(5,10), strand=-1)
        f2 = SeqFeature(FeatureLocation(12,15), strand=-1)
        f = make_join_feature([f1,f2])
        self.assertEqual(_insdc_feature_location_string(f),
                         "complement(join(6..10,13..15))")
        self.check(s, f, reverse_complement("CCCCC"+"TTT"))

00273     def test_simple_dna_join(self):
        """Extract feature from DNA (join, strand -1, before position)"""
        s = Seq("AAAAACCCCCTTTTTGGGGG", generic_dna)
        f1 = SeqFeature(FeatureLocation(BeforePosition(5),10), strand=-1)
        f2 = SeqFeature(FeatureLocation(12,15), strand=-1)
        f = make_join_feature([f1,f2])
        self.assertEqual(_insdc_feature_location_string(f),
                         "complement(join(<6..10,13..15))")
        self.check(s, f, reverse_complement("CCCCC"+"TTT"))

00283     def test_simple_dna_join_after(self):
        """Extract feature from DNA (join, strand -1, after position)"""
        s = Seq("AAAAACCCCCTTTTTGGGGG", generic_dna)
        f1 = SeqFeature(FeatureLocation(5,10), strand=-1)
        f2 = SeqFeature(FeatureLocation(12,AfterPosition(15)), strand=-1)
        f = make_join_feature([f1,f2])
        self.assertEqual(_insdc_feature_location_string(f),
                         "complement(join(6..10,13..>15))")
        self.check(s, f, reverse_complement("CCCCC"+"TTT"))

00293     def test_mixed_strand_dna_join(self):
        """Extract feature from DNA (join, mixed strand)"""
        s = Seq("AAAAACCCCCTTTTTGGGGG", generic_dna)
        f1 = SeqFeature(FeatureLocation(5,10), strand=+1)
        f2 = SeqFeature(FeatureLocation(12,15), strand=-1)
        f = make_join_feature([f1,f2])
        self.assertEqual(_insdc_feature_location_string(f),
                         "join(6..10,complement(13..15))")
        self.check(s, f, "CCCCC"+reverse_complement("TTT"))

00303     def test_mixed_strand_dna_multi_join(self):
        """Extract feature from DNA (multi-join, mixed strand)"""
        s = Seq("AAAAACCCCCTTTTTGGGGG", generic_dna)
        f1 = SeqFeature(FeatureLocation(5,10), strand=+1)
        f2 = SeqFeature(FeatureLocation(12,15), strand=-1)
        f3 = SeqFeature(FeatureLocation(BeforePosition(0),5), strand=+1)
        f = make_join_feature([f1,f2,f3])
        self.assertEqual(_insdc_feature_location_string(f),
                         "join(6..10,complement(13..15),<1..5)")
        self.check(s, f, "CCCCC"+reverse_complement("TTT")+"AAAAA")

00314     def test_simple_protein(self):
        """Extract feature from protein (simple)"""
        s = Seq("ABCDEFGHIJKLMNOPQRSTUVWXYZ", generic_protein)
        f = SeqFeature(FeatureLocation(5,10))
        self.assertEqual(_insdc_feature_location_string(f),"6..10")
        self.check(s, f, "FGHIJ")

00321     def test_simple_protein_join(self):
        """Extract feature from protein (join)"""
        s = Seq("ABCDEFGHIJKLMNOPQRSTUVWXYZ", generic_protein)
        f1 = SeqFeature(FeatureLocation(5,10))
        f2 = SeqFeature(FeatureLocation(15,20))
        f = make_join_feature([f1,f2])
        self.assertEqual(_insdc_feature_location_string(f),
                         "join(6..10,16..20)")
        self.check(s, f, "FGHIJ"+"PQRST")

00331     def test_simple_protein_multi_join(self):
        """Extract feature from protein (multi-join)"""
        s = Seq("ABCDEFGHIJKLMNOPQRSTUVWXYZ", generic_protein)
        f1 = SeqFeature(FeatureLocation(1,2))
        f2 = SeqFeature(FeatureLocation(8,9))
        f3 = SeqFeature(FeatureLocation(14,16))
        f4 = SeqFeature(FeatureLocation(24,25))
        f5 = SeqFeature(FeatureLocation(19,20))
        f6 = SeqFeature(FeatureLocation(7,8))
        f7 = SeqFeature(FeatureLocation(14,15))
        f8 = SeqFeature(FeatureLocation(13,14))
        f = make_join_feature([f1,f2,f3,f4,f5,f6,f7,f8])
        self.check(s, f, "BIOPYTHON")

00345 class SeqFeatureCreation(unittest.TestCase):
    """Test basic creation of SeqFeatures.
    """

00349     def test_qualifiers(self):
        """Pass in qualifiers to SeqFeatures.
        """
        f = SeqFeature(FeatureLocation(10,20), strand=+1, type="CDS")
        self.assertEqual(f.qualifiers, {})
        f = SeqFeature(FeatureLocation(10,20), strand=+1, type="CDS",
                qualifiers={"test": ["a test"]})
        self.assertEqual(f.qualifiers["test"], ["a test"])

00358 class FeatureWriting(unittest.TestCase):
    def setUp(self):
        self.record = SeqRecord(Seq("ACGT"*100, generic_dna),
                                id="Test", name="Test", description="Test")
    def write_read_check(self, format):
        handle = StringIO()
        SeqIO.write([self.record], handle, format)
        handle.seek(0)
        record2 = SeqIO.read(handle, format)
        compare_record(self.record, record2)
    
    def write_read_checks(self, formats=["gb", "embl"]):
        for f in formats:
            self.write_read_check(f)

00373     def test_exact(self):
        """Features: write/read simple exact locations."""
        #Note we don't have to explicitly give an ExactPosition object,
        #and integer will also work:
        f = SeqFeature(FeatureLocation(10,20), strand=+1, type="CDS")
        self.assertEqual(_insdc_feature_location_string(f),
                         "11..20")
        self.record.features.append(f)
        f = SeqFeature(FeatureLocation(30,40), strand=-1, type="CDS")
        self.assertEqual(_insdc_feature_location_string(f),
                         "complement(31..40)")
        self.record.features.append(f)
        f = SeqFeature(FeatureLocation(ExactPosition(50),ExactPosition(60)), \
                       strand=+1, type="CDS")
        self.assertEqual(_insdc_feature_location_string(f),
                         "51..60")
        self.record.features.append(f)
        self.write_read_checks()

00392     def test_between(self):
        """Features: write/read simple between locations."""
        #Note we don't use the BetweenPosition any more!
        f = SeqFeature(FeatureLocation(10,10), strand=+1, type="variation")
        self.assertEqual(_insdc_feature_location_string(f),
                         "10^11")
        self.record.features.append(f)
        f = SeqFeature(FeatureLocation(20,20), strand=-1, type="variation")
        self.assertEqual(_insdc_feature_location_string(f),
                         "complement(20^21)")
        self.record.features.append(f)
        self.write_read_checks()

00405     def test_join(self):
        """Features: write/read simple join locations."""
        f1 = SeqFeature(FeatureLocation(10,20), strand=+1)
        f2 = SeqFeature(FeatureLocation(25,40), strand=+1)
        f = make_join_feature([f1,f2])
        self.record.features.append(f)
        self.assertEqual(_insdc_feature_location_string(f),
                         "join(11..20,26..40)")
        f1 = SeqFeature(FeatureLocation(110,120), strand=+1)
        f2 = SeqFeature(FeatureLocation(125,140), strand=+1)
        f3 = SeqFeature(FeatureLocation(145,150), strand=+1)
        f = make_join_feature([f1,f2,f3], "CDS")
        self.assertEqual(_insdc_feature_location_string(f),
                         "join(111..120,126..140,146..150)")
        self.record.features.append(f)
        f1 = SeqFeature(FeatureLocation(210,220), strand=-1)
        f2 = SeqFeature(FeatureLocation(225,240), strand=-1)
        f = make_join_feature([f1,f2], ftype="gene")
        self.assertEqual(_insdc_feature_location_string(f),
                         "complement(join(211..220,226..240))")
        self.record.features.append(f)
        f1 = SeqFeature(FeatureLocation(310,320), strand=-1)
        f2 = SeqFeature(FeatureLocation(325,340), strand=-1)
        f3 = SeqFeature(FeatureLocation(345,350), strand=-1)
        f = make_join_feature([f1,f2,f3], "CDS")
        self.assertEqual(_insdc_feature_location_string(f),
                         "complement(join(311..320,326..340,346..350))")
        self.record.features.append(f)
        self.write_read_checks()

00435     def test_fuzzy_join(self):
        """Features: write/read fuzzy join locations."""
        f1 = SeqFeature(FeatureLocation(BeforePosition(10),20), strand=+1)
        f2 = SeqFeature(FeatureLocation(25,AfterPosition(40)), strand=+1)
        f = make_join_feature([f1,f2])
        self.record.features.append(f)
        self.assertEqual(_insdc_feature_location_string(f),
                         "join(<11..20,26..>40)")
        f1 = SeqFeature(FeatureLocation(OneOfPosition([ExactPosition(107),
                                                       ExactPosition(110)]),120),
                        strand=+1)
        f2 = SeqFeature(FeatureLocation(125,140), strand=+1)
        f3 = SeqFeature(FeatureLocation(145,WithinPosition(150,10)), strand=+1)
        f = make_join_feature([f1,f2,f3], "CDS")
        self.assertEqual(_insdc_feature_location_string(f),
                         "join(one-of(108,111)..120,126..140,146..(150.160))")
        self.record.features.append(f)
        f1 = SeqFeature(FeatureLocation(BeforePosition(210),220), strand=-1)
        f2 = SeqFeature(FeatureLocation(225,WithinPosition(240,4)), strand=-1)
        f = make_join_feature([f1,f2], "gene")
        self.assertEqual(_insdc_feature_location_string(f),
                         "complement(join(<211..220,226..(240.244)))")
        self.record.features.append(f)
        f1 = SeqFeature(FeatureLocation(AfterPosition(310),320), strand=-1)
        f2 = SeqFeature(FeatureLocation(325,OneOfPosition([ExactPosition(340),
                                                           ExactPosition(337)])),
                        strand=-1)
        f3 = SeqFeature(FeatureLocation(345,WithinPosition(350,5)), strand=-1)
        f = make_join_feature([f1,f2,f3], "CDS")
        self.assertEqual(_insdc_feature_location_string(f),
                         "complement(join(>311..320,326..one-of(340,337),346..(350.355)))")
        self.record.features.append(f)
        self.write_read_checks()

00469     def test_before(self):
        """Features: write/read simple before locations."""
        f = SeqFeature(FeatureLocation(BeforePosition(5),10), \
                       strand=+1, type="CDS")
        self.assertEqual(_insdc_feature_location_string(f),
                         "<6..10")
        self.record.features.append(f)
        f = SeqFeature(FeatureLocation(BeforePosition(15),BeforePosition(20)), \
                       strand=+1, type="CDS")
        self.assertEqual(_insdc_feature_location_string(f),
                         "<16..<20")
        self.record.features.append(f)
        f = SeqFeature(FeatureLocation(25,BeforePosition(30)), \
                       strand=+1, type="CDS")
        self.assertEqual(_insdc_feature_location_string(f),
                         "26..<30")
        self.record.features.append(f)
        f = SeqFeature(FeatureLocation(BeforePosition(35),40), \
                       strand=-1, type="CDS")
        self.assertEqual(_insdc_feature_location_string(f),
                         "complement(<36..40)")
        self.record.features.append(f)
        f = SeqFeature(FeatureLocation(BeforePosition(45),BeforePosition(50)), \
                       strand=-1, type="CDS")
        self.assertEqual(_insdc_feature_location_string(f),
                         "complement(<46..<50)")
        self.record.features.append(f)
        f = SeqFeature(FeatureLocation(55,BeforePosition(60)), \
                       strand=-1, type="CDS")
        self.assertEqual(_insdc_feature_location_string(f),
                         "complement(56..<60)")
        self.record.features.append(f)
        self.write_read_checks()
        
00503     def test_after(self):
        """Features: write/read simple after locations."""
        f = SeqFeature(FeatureLocation(AfterPosition(5),10), \
                       strand=+1, type="CDS")
        self.assertEqual(_insdc_feature_location_string(f),
                         ">6..10")
        self.record.features.append(f)
        f = SeqFeature(FeatureLocation(AfterPosition(15),AfterPosition(20)), \
                       strand=+1, type="CDS")
        self.assertEqual(_insdc_feature_location_string(f),
                         ">16..>20")
        self.record.features.append(f)
        f = SeqFeature(FeatureLocation(25,AfterPosition(30)), \
                       strand=+1, type="CDS")
        self.assertEqual(_insdc_feature_location_string(f),
                         "26..>30")
        self.record.features.append(f)
        f = SeqFeature(FeatureLocation(AfterPosition(35),40), \
                       strand=-1, type="CDS")
        self.assertEqual(_insdc_feature_location_string(f),
                         "complement(>36..40)")
        self.record.features.append(f)
        f = SeqFeature(FeatureLocation(AfterPosition(45),AfterPosition(50)), \
                       strand=-1, type="CDS")
        self.assertEqual(_insdc_feature_location_string(f),
                         "complement(>46..>50)")
        self.record.features.append(f)
        f = SeqFeature(FeatureLocation(55,AfterPosition(60)), \
                       strand=-1, type="CDS")
        self.assertEqual(_insdc_feature_location_string(f),
                         "complement(56..>60)")
        self.record.features.append(f)
        self.write_read_checks()

00537     def test_oneof(self):
        """Features: write/read simple one-of locations."""
        start = OneOfPosition([ExactPosition(0),ExactPosition(3),ExactPosition(6)])
        f = SeqFeature(FeatureLocation(start,21), strand=+1, type="CDS")
        self.assertEqual(_insdc_feature_location_string(f),
                         "one-of(1,4,7)..21")
        self.record.features.append(f)
        start = OneOfPosition([ExactPosition(x) for x in [10,13,16]])
        end = OneOfPosition([ExactPosition(x) for x in [41,44,50]])
        f = SeqFeature(FeatureLocation(start,end), strand=+1, type="gene")
        self.assertEqual(_insdc_feature_location_string(f),
                         "one-of(11,14,17)..one-of(41,44,50)")
        self.record.features.append(f)
        end = OneOfPosition([ExactPosition(x) for x in [30,33]])
        f = SeqFeature(FeatureLocation(27,end), strand=+1, type="gene")
        self.assertEqual(_insdc_feature_location_string(f),
                         "28..one-of(30,33)")
        self.record.features.append(f)
        start = OneOfPosition([ExactPosition(x) for x in [36,40]])
        f = SeqFeature(FeatureLocation(start,46), strand=-1, type="CDS")
        self.assertEqual(_insdc_feature_location_string(f),
                         "complement(one-of(37,41)..46)")
        self.record.features.append(f)
        start = OneOfPosition([ExactPosition(x) for x in [45,60]])
        end = OneOfPosition([ExactPosition(x) for x in [70,90]])
        f = SeqFeature(FeatureLocation(start,end), strand=-1, type="CDS")
        self.assertEqual(_insdc_feature_location_string(f),
                         "complement(one-of(46,61)..one-of(70,90))")
        self.record.features.append(f)
        end = OneOfPosition([ExactPosition(x) for x in [60,63]])
        f = SeqFeature(FeatureLocation(55,end), strand=-1, type="tRNA")
        self.assertEqual(_insdc_feature_location_string(f),
                         "complement(56..one-of(60,63))")
        self.record.features.append(f)
        self.write_read_checks()

00573     def test_within(self):
        """Features: write/read simple within locations."""
        f = SeqFeature(FeatureLocation(WithinPosition(2,6),10), \
                       strand=+1, type="CDS")
        self.assertEqual(_insdc_feature_location_string(f),
                         "(3.9)..10")
        self.record.features.append(f)
        f = SeqFeature(FeatureLocation(WithinPosition(12,6),
                                       WithinPosition(20,8)), \
                       strand=+1, type="CDS")
        self.assertEqual(_insdc_feature_location_string(f),
                         "(13.19)..(20.28)")
        self.record.features.append(f)
        f = SeqFeature(FeatureLocation(25,WithinPosition(30,3)), \
                       strand=+1, type="misc_feature")
        self.assertEqual(_insdc_feature_location_string(f),
                         "26..(30.33)")
        self.record.features.append(f)
        f = SeqFeature(FeatureLocation(WithinPosition(35,4),40), \
                       strand=-1, type="rRNA")
        self.assertEqual(_insdc_feature_location_string(f),
                         "complement((36.40)..40)")
        self.record.features.append(f)
        f = SeqFeature(FeatureLocation(WithinPosition(45,2),
                                       WithinPosition(50,3)), \
                       strand=-1, type="repeat_region")
        self.assertEqual(_insdc_feature_location_string(f),
                         "complement((46.48)..(50.53))")
        self.record.features.append(f)
        f = SeqFeature(FeatureLocation(55,WithinPosition(60,5)), \
                       strand=-1, type="CDS")
        self.assertEqual(_insdc_feature_location_string(f),
                         "complement(56..(60.65))")
        self.record.features.append(f)
        self.write_read_checks()
        
00609 class NC_000932(unittest.TestCase):
    #This includes an evil dual strand gene
    basename = "NC_000932"
    emblname = None # "AP000423" has different annotation (e.g. more CDS)
    table = 11
    skip_trans_test = ["gi|7525080|ref|NP_051037.1|", #dual-strand
                       "gi|7525057|ref|NP_051038.1|", #dual-strand
                       "gi|90110725|ref|NP_051109.2|", #Invalid annotation? No start codon
                       ]
    __doc__ = "Tests using %s GenBank and FASTA files from the NCBI" % basename
    #TODO - neat way to change the docstrings...

    def setUp(self):
        self.gb_filename = os.path.join("GenBank",self.basename+".gb")
        self.ffn_filename = os.path.join("GenBank",self.basename+".ffn")
        self.faa_filename = os.path.join("GenBank",self.basename+".faa")
        self.fna_filename = os.path.join("GenBank",self.basename+".fna")
        if self.emblname:
            self.embl_filename = os.path.join("EMBL",self.emblname+".embl")

    #These tests only need the GenBank file and the FAA file:
    def test_CDS(self):
        #"""Checking GenBank CDS translations vs FASTA faa file."""
        gb_record = SeqIO.read(open(self.gb_filename),"genbank")
        gb_cds = list(SeqIO.parse(open(self.gb_filename),"genbank-cds"))
        fasta = list(SeqIO.parse(open(self.faa_filename),"fasta"))
        compare_records(gb_cds, fasta)
        cds_features = [f for f in gb_record.features if f.type=="CDS"]
        self.assertEqual(len(cds_features), len(fasta))
        for f, r in zip(cds_features, fasta):
            if r.id in self.skip_trans_test:
                continue
            #Get the nucleotides and translate them
            nuc = f.extract(gb_record.seq)
            pro = nuc.translate(table=self.table, cds=True)
            #print r.id, nuc, pro, r.seq
            #print f
            if pro[-1] == "*":
                self.assertEqual(str(pro)[:-1], str(r.seq))
            else:
                self.assertEqual(str(pro), str(r.seq))

00651 class NC_005816(NC_000932):
    basename = "NC_005816"
    emblname = "AE017046"
    table = 11
    skip_trans_test = []
    __doc__ = "Tests using %s GenBank and FASTA files from the NCBI" % basename

    def test_GenBank_vs_EMBL(self):
        if not self.emblname:
            return
        gb_record = SeqIO.read(open(self.gb_filename),"genbank")
        embl_record = SeqIO.read(open(self.embl_filename),"embl")
        return compare_record(gb_record, embl_record, expect_minor_diffs=True)

    def test_Translations(self):
        #"""Checking translation of FASTA features (faa vs ffn)."""
        faa_records = list(SeqIO.parse(open(self.faa_filename),"fasta"))
        ffn_records = list(SeqIO.parse(open(self.ffn_filename),"fasta"))
        self.assertEqual(len(faa_records),len(ffn_records))
        for faa, fna in zip(faa_records, ffn_records):
            translation = fna.seq.translate(self.table, cds=True)
            if faa.id in self.skip_trans_test:
                continue
            if (str(translation) != str(faa.seq)) \
            and (str(translation) != str(faa.seq)+"*"):
                t = SeqRecord(translation, id="Translation",
                              description="Table %s" % self.table)
                raise ValueError("FAA vs FNA translation problem:\n%s\n%s\n%s\n" \
                                 % (fna.format("fasta"),
                                    t.format("fasta"),
                                    faa.format("fasta")))
    
    def test_Genome(self):
        #"""Checking GenBank sequence vs FASTA fna file."""
        gb_record = SeqIO.read(open(self.gb_filename),"genbank")
        fa_record = SeqIO.read(open(self.fna_filename),"fasta")
        compare_record(gb_record, fa_record)
        if self.emblname is None:
            return
        embl_record = SeqIO.read(open(self.embl_filename),"embl")
        compare_record(gb_record, embl_record, expect_minor_diffs=True)

    def test_Features(self):
        #"""Checking GenBank features sequences vs FASTA ffn file."""
        gb_record = SeqIO.read(open(self.gb_filename),"genbank")
        features = [f for f in gb_record.features if f.type=="CDS"]
        fa_records = list(SeqIO.parse(open(self.ffn_filename),"fasta"))
        self.assertEqual(len(fa_records), len(features))
        #This assumes they are in the same order...
        for fa_record, f in zip(fa_records, features):
            #TODO - check the FASTA ID line against the co-ordinates?
            f_seq = f.extract(gb_record.seq)
            self.assertEqual(len(fa_record.seq),
                             len(f_seq))
            self.assertEqual(str(fa_record.seq),
                             str(f_seq))


00709 class TestWriteRead(unittest.TestCase):
    """Test can write and read back files."""
00711     def test_NC_000932(self):
        """Write and read back NC_000932.gb"""
        write_read(os.path.join("GenBank", "NC_000932.gb"), "gb")

00715     def test_NC_005816(self):
        """Write and read back NC_005816.gb"""
        write_read(os.path.join("GenBank", "NC_005816.gb"), "gb")

00719     def test_gbvrl1_start(self):
        """Write and read back gbvrl1_start.seq"""
        write_read(os.path.join("GenBank", "gbvrl1_start.seq"), "gb")

00723     def test_NT_019265(self):
        """Write and read back NT_019265.gb"""
        write_read(os.path.join("GenBank", "NT_019265.gb"), "gb")

00727     def test_cor6(self):
        """Write and read back cor6_6.gb"""
        write_read(os.path.join("GenBank", "cor6_6.gb"), "gb")

00731     def test_arab1(self):
        """Write and read back arab1.gb"""
        write_read(os.path.join("GenBank", "arab1.gb"), "gb")

00735     def test_one_of(self):
        """Write and read back of_one.gb"""
        write_read(os.path.join("GenBank", "one_of.gb"), "gb")

00739     def test_pri1(self):
        """Write and read back pri1.gb"""
        write_read(os.path.join("GenBank", "pri1.gb"), "gb")

00743     def test_noref(self):
        """Write and read back noref.gb"""
        write_read(os.path.join("GenBank", "noref.gb"), "gb")

00747     def test_origin_line(self):
        """Write and read back origin_line.gb"""
        write_read(os.path.join("GenBank", "origin_line.gb"), "gb")

00751     def test_dbsource_wrap(self):
        """Write and read back dbsource_wrap.gb"""
        write_read(os.path.join("GenBank", "dbsource_wrap.gb"), "gb", ["gb"])
        #Protein so can't convert this to EMBL format

00756     def test_blank_seq(self):
        """Write and read back blank_seq.gb"""
        write_read(os.path.join("GenBank", "blank_seq.gb"), "gb", ["gb"])
        #Protein so can't convert this to EMBL format

00761     def test_extra_keywords(self):
        """Write and read back extra_keywords.gb"""
        write_read(os.path.join("GenBank", "extra_keywords.gb"), "gb")

00765     def test_protein_refseq(self):
        """Write and read back protein_refseq.gb"""
        write_read(os.path.join("GenBank", "protein_refseq.gb"), "gb", ["gb"])
        #Protein so can't convert this to EMBL format

00770     def test_protein_refseq2(self):
        """Write and read back protein_refseq2.gb"""
        write_read(os.path.join("GenBank", "protein_refseq2.gb"), "gb", ["gb"])
        #Protein so can't convert this to EMBL format

00775     def test_AAA03323(self):
        """Write and read back AAA03323.embl"""
        write_read(os.path.join("EMBL", "AAA03323.embl"), "embl")

00779     def test_AE017046(self):
        """Write and read back AE017046.embl"""
        write_read(os.path.join("EMBL", "AE017046.embl"), "embl")

00783     def test_DD231055_edited(self):
        """Write and read back DD231055_edited.embl"""
        write_read(os.path.join("EMBL", "DD231055_edited.embl"), "embl")

00787     def test_Human_contigs(self):
        """Write and read back Human_contigs.embl"""
        write_read(os.path.join("EMBL", "Human_contigs.embl"), "embl")

00791     def test_SC10H5(self):
        """Write and read back SC10H5.embl"""
        write_read(os.path.join("EMBL", "SC10H5.embl"), "embl")

00795     def test_TRBG361(self):
        """Write and read back TRBG361.embl"""
        write_read(os.path.join("EMBL", "TRBG361.embl"), "embl")

00799     def test_U87107(self):
        """Write and read back U87107.embl"""
        write_read(os.path.join("EMBL", "U87107.embl"), "embl")


if __name__ == "__main__":
    runner = unittest.TextTestRunner(verbosity = 2)
    unittest.main(testRunner=runner)

Generated by  Doxygen 1.6.0   Back to index