Logo Search packages:      
Sourcecode: python-biopython version File versions  Download package

test_EmbossPrimer.py

#!/usr/bin/env python
"""Tests for Primer-based programs in the Emboss suite.
"""
# standard library
import sys
import os
import unittest

# local stuff
from Bio.Emboss import PrimerSearch, Primer3


class Primer3ParseTest(unittest.TestCase):
    def setUp(self):
        self.test_files = \
          [os.path.join("Emboss", "bac_find.primer3"),
           os.path.join("Emboss", "cds_forward.primer3"),
           os.path.join("Emboss", "cds_reverse.primer3"),
           os.path.join("Emboss", "short.primer3"),
           os.path.join("Emboss", "internal_oligo.primer3"),
           ]

    def test_simple_parse(self):
        """Make sure that we can use all single target primer3 files.
        """
        for file in self.test_files:
            # First using read...
            h = open(file, "r")
            Primer3.read(h)
            h.close()
            # Now using parse...
            h = open(file, "r")
            self.assertEqual(1, len(list(Primer3.parse(h))))
            h.close()

    def test_indepth_regular_parse(self):
        """Make sure we get the data from normal primer3 files okay.
        """
        regular_file = self.test_files[0]
        h = open(regular_file, "r")
        primer_info = Primer3.read(h)
        h.close()

        self.assertEqual(len(primer_info.primers), 5)
        self.assertEqual(primer_info.comments,
                         "# PRIMER3 RESULTS FOR AC074298\n")
        self.assertEqual(primer_info.primers[1].forward_seq,
                         "CCGGTTTCTCTGGTTGAAAA")
        self.assertEqual(primer_info.primers[2].reverse_seq,
                         "TCACATTCCCAAATGTAGATCG")
        self.assertEqual(primer_info.primers[0].size, 218)
        self.assertEqual(primer_info.primers[3].forward_start, 112)
        self.assertEqual(primer_info.primers[3].forward_length, 20)
        self.assertEqual(primer_info.primers[3].forward_tm, 59.57)
        self.assertEqual(primer_info.primers[3].forward_gc, 45.00)
        self.assertEqual(primer_info.primers[4].reverse_start, 304)
        self.assertEqual(primer_info.primers[4].reverse_length, 22)
        self.assertEqual(primer_info.primers[4].reverse_tm, 59.61)
        self.assertEqual(primer_info.primers[4].reverse_gc, 40.91)

    def test_in_depth_single_parse(self):
        """Make sure we get info right from a single primer find.
        """
        file = self.test_files[1]
        h = open(file, "r")
        primer_info = Primer3.read(h)
        h.close()

        self.assertEqual(len(primer_info.primers), 5)
        self.assertEqual(primer_info.comments,
                         "# PRIMER3 RESULTS FOR 26964-28647#\n")
        self.assertEqual(primer_info.primers[1].reverse_seq, "")
        self.assertEqual(primer_info.primers[3].forward_seq, "TGTGATTGCTTGAGCTGGAC")
        self.assertEqual(primer_info.primers[3].forward_start, 253)

    def test_internal_oligo_single_parse(self):
        ''' Make sure we can parse an internal oligo file correctly '''
        # these files are generated when designing hybridization probes.
        file = self.test_files[4]
        h = open(file, "r")
        primer_info = Primer3.read(h)
        h.close()

        self.assertEqual(len(primer_info.primers), 5)
        self.assertEqual(primer_info.comments,
                         "# EPRIMER3 RESULTS FOR YNL138W-A\n")
        self.assertEqual(primer_info.primers[0].internal_length, 22)
        self.assertEqual(primer_info.primers[1].internal_seq,
                         'TTGCGCTTTAGTTTGAATTGAA')
        self.assertEqual(primer_info.primers[2].internal_tm, 58.62)
        self.assertEqual(primer_info.primers[3].internal_start, 16)
        self.assertEqual(primer_info.primers[4].internal_gc, 35.00)

    def test_mutli_record_fwd(self):
        """Test parsing multiple primer sets (NirK forward)"""
        h = open(os.path.join("Emboss", "NirK.primer3"))
        targets = list(Primer3.parse(h))
        h.close()

        self.assertEqual(len(targets), 16)
        for target in targets:
            self.assertEqual(len(target.primers), 5)

        self.assertEqual(targets[0].primers[0].forward_seq,
                         "GCAAACTGAAAAGCGGACTC")
        self.assertEqual(targets[0].primers[1].forward_seq,
                         "GGGACGTACTTTCGCACAAT")
        self.assertEqual(targets[0].primers[2].forward_seq,
                         "GTCTTATGCGTGGTGGAGGT")
        self.assertEqual(targets[0].primers[3].forward_seq,
                         "GTACATCAACATCCGCAACG")
        self.assertEqual(targets[0].primers[4].forward_seq,
                         "CGTACATCAACATCCGCAAC")

        self.assertEqual(targets[1].primers[0].forward_seq,
                         "GGAAGTGCTTCTCGTTTTCG")
        self.assertEqual(targets[1].primers[1].forward_seq,
                         "TACAGAGCGTCACGGATGAG")
        self.assertEqual(targets[1].primers[2].forward_seq,
                         "TTGTCATCGTGCTCTTCGTC")
        self.assertEqual(targets[1].primers[3].forward_seq,
                         "GACTCCAACCTCAGCTTTCG")
        self.assertEqual(targets[1].primers[4].forward_seq,
                         "GGCACGAAGAAGGACAGAAG")

        self.assertEqual(targets[15].primers[0].forward_seq,
                         "TGCTTGAAAATGACGCACTC")
        self.assertEqual(targets[15].primers[1].forward_seq,
                         "CTCGCTGGCTAGGTCATAGG")
        self.assertEqual(targets[15].primers[2].forward_seq,
                         "TATCGCACCAAACACGGTAA")
        self.assertEqual(targets[15].primers[3].forward_seq,
                         "CGATTACCCTCACCGTCACT")
        self.assertEqual(targets[15].primers[4].forward_seq,
                         "TATCGCAACCACTGAGCAAG")


    def test_mutli_record_full(self):
        """Test parsing multiple primer sets (NirK full)"""
        h = open(os.path.join("Emboss", "NirK_full.primer3"))
        targets = list(Primer3.parse(h))
        h.close()

        self.assertEqual(len(targets), 16)
        for target in targets:
            self.assertEqual(len(target.primers), 5)

        self.assertEqual(targets[15].primers[0].forward_seq,
                         "ACTCACTTCGGCTGAATGCT")
        self.assertEqual(targets[15].primers[1].forward_seq,
                         "GGCGATTAGCGCTGTCTATC")
        self.assertEqual(targets[15].primers[2].forward_seq,
                         "ACTCACTTCGGCTGAATGCT")
        self.assertEqual(targets[15].primers[3].forward_seq,
                         "TAGGCGTATAGACCGGGTTG")
        self.assertEqual(targets[15].primers[4].forward_seq,
                         "AGCAAGCTGACCACTGGTTT")

        self.assertEqual(targets[15].primers[0].reverse_seq,
                         "CATTTAATCCGGATGCCAAC")
        self.assertEqual(targets[15].primers[1].reverse_seq,
                         "TGGCCTTTCTCTCCTCTTCA")
        self.assertEqual(targets[15].primers[2].reverse_seq,
                         "ATTTAATCCGGATGCCAACA")
        self.assertEqual(targets[15].primers[3].reverse_seq,
                         "CACACATTATTGGCGGTCAC")
        self.assertEqual(targets[15].primers[4].reverse_seq,
                         "TCTGAAACCACCAAGGAAGC")

        self.assertEqual(targets[15].primers[0].internal_seq,
                         "CCCACCAATATTTGGCTAGC")
        self.assertEqual(targets[15].primers[1].internal_seq,
                         "AATCTTCTGTGCACCTTGCC")
        self.assertEqual(targets[15].primers[2].internal_seq,
                         "CCCACCAATATTTGGCTAGC")
        self.assertEqual(targets[15].primers[3].internal_seq,
                         "TGAGCCTGTGTTCCACACAT")
        self.assertEqual(targets[15].primers[4].internal_seq,
                         "CTATGCCCTTCTGCCACAAT")


class PrimersearchParseTest(unittest.TestCase):
    def setUp(self):
        self.test_files = \
          [os.path.join("Emboss", "bac_find.psearch")]

    def test_simple_parse(self):
        """Make sure that we can parse all primersearch files.
        """
        for file in self.test_files:
            h = open(file, "r")
            PrimerSearch.read(h)
            h.close()

    def test_in_depth_normal_parse(self):
        """Make sure the output from a simple primersearch file is correct.
        """
        file = self.test_files[0]
        h = open(file, "r")
        amp_info = PrimerSearch.read(h)
        h.close()

        self.assertEqual(len(amp_info.amplifiers), 1)
        self.assert_("Test" in amp_info.amplifiers)
        self.assertEqual(len(amp_info.amplifiers["Test"]), 1)

        self.assertEqual(amp_info.amplifiers["Test"][0].length, 218)
        self.assertEqual(amp_info.amplifiers["Test"][0].hit_info,
          "AC074298 AC074298 \n"
          "\tTelomere associated sequence for Arabidopsis thaliana "
          "TEL1N from chromosome I, complete sequence.\n"
          "\tCCGGTTTCTCTGGTTGAAAA hits forward strand at 114 with "
          "0 mismatches\n"
          "\tTCACATTCCCAAATGTAGATCG hits reverse strand at [114] with "
          "0 mismatches")

00217 class PrimerSearchInputTest(unittest.TestCase):
    """Test creating input files for primersearch.
    """
    def setUp(self):
        pass

00223     def test_primer_representation(self):
        """Make sure we can output primer information correctly.
        """
        p_info = PrimerSearch.InputRecord()
        p_info.add_primer_set("Test", "GATC", "CATG")
        p_info.add_primer_set("Test2", "AATA", "TTAT")

        output = str(p_info)
        self.assertEqual(output,
                         "Test GATC CATG\n"
                         "Test2 AATA TTAT\n")

if __name__ == "__main__":
    runner = unittest.TextTestRunner(verbosity = 2)
    unittest.main(testRunner=runner)

Generated by  Doxygen 1.6.0   Back to index